View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_51 (Length: 233)
Name: NF21359_low_51
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 10 - 138
Target Start/End: Original strand, 1234309 - 1234434
Alignment:
| Q |
10 |
aagaatatctagttggaagcctatccagcaacaaatgcgaaaatggagttaaaatatgttttgagactcattaaattactaagttttggttttaggcttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || | |||| ||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1234309 |
aagaatatctagttggaagcctatccagcaacaaatgccaatacatagtt-aaatatg--ttgagactcattaaattactaagttttgtttttaggcttc |
1234405 |
T |
 |
| Q |
110 |
attaaaataatcacacggcatttcttgtc |
138 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
1234406 |
attaaaaaaatcacacggcatttcttgtc |
1234434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University