View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_57 (Length: 224)
Name: NF21359_low_57
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 66 - 209
Target Start/End: Original strand, 7037121 - 7037264
Alignment:
| Q |
66 |
gaaaagaattatgaaatatatgtgtatgtgtgtataacactcaaattgtgacatgtaacagttgatagcttcatccgctgggacattgatattttatgaa |
165 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7037121 |
gaaaagatttatgaaatatatgtgtatgtgtgtataacactcaaattgtgacatgtaacagttgatagcttcatccactgggacattgatattttatgaa |
7037220 |
T |
 |
| Q |
166 |
cttcgatagtatataactactactttcatattttggggtctgtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7037221 |
cttcgatagtatataactactactttcatattctggggtctgtg |
7037264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 66
Target Start/End: Original strand, 7037015 - 7037058
Alignment:
| Q |
23 |
cagttcatgcatcttttaatacattcatttctatctagttatcg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7037015 |
cagttcatgcatcttttaatacattcatttctatctagttatcg |
7037058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University