View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_58 (Length: 222)
Name: NF21359_low_58
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 26015794 - 26015857
Alignment:
| Q |
16 |
attattcttaggtgatttaatatttagttagtagatgcattttgaattttcacttaattgtctt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
26015794 |
attattcttaggtgatttaatatttagttagtagatacattttgagttttcaactaattgtctt |
26015857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 56110028 - 56110091
Alignment:
| Q |
16 |
attattcttaggtgatttaatatttagttagtagatgcattttgaattttcacttaattgtctt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
56110028 |
attattcttaggtgatttaatatttagttagtagatacattttgagttttcaactaattgtctt |
56110091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University