View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21359_low_59 (Length: 213)

Name: NF21359_low_59
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21359_low_59
NF21359_low_59
[»] chr2 (1 HSPs)
chr2 (39-197)||(11280029-11280187)
[»] chr5 (1 HSPs)
chr5 (45-93)||(896147-896195)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 39 - 197
Target Start/End: Original strand, 11280029 - 11280187
Alignment:
39 ttaaaagtgagttaactcgcaccgaaaaatgtcaagcgtgagttaacttacattgcaacaagggaatgagcagcnnnnnnnnggagaagagtaattttcg 138  Q
    |||||||||| |||||| ||||| |||| ||||||||||||||||||||||||||||  ||||||||||||| |        |||||| || |||||||     
11280029 ttaaaagtgaattaacttgcaccaaaaagtgtcaagcgtgagttaacttacattgcagtaagggaatgagcaacaacaaaaaggagaaaagcaattttca 11280128  T
139 gcgcccccggtgaccataaccttgcgggccaggctgcaagaaatggtcttccaaggatg 197  Q
     | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
11280129 acacccccgatgaccataaccttgcgggccaggctgcaagaaatggtcttccaaggatg 11280187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 896147 - 896195
Alignment:
45 gtgagttaactcgcaccgaaaaatgtcaagcgtgagttaacttacattg 93  Q
    |||||||||||| | |||||||||||| |||| |||||||||| |||||    
896147 gtgagttaactcacgccgaaaaatgtcgagcgagagttaacttccattg 896195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University