View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_62 (Length: 211)
Name: NF21359_low_62
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 34469294 - 34469466
Alignment:
| Q |
19 |
gaagctaggtttttaagcaaaattttgtat--gggagttcatgtagtatatatataagataaactatgtgtgttcgtttgttgtataactaatattctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34469294 |
gaagctaggtttttaagcaaaattttgtatctgggagttcatgtagtata------agataaactatgtgtgttcgttcgttgtataactaatattctga |
34469387 |
T |
 |
| Q |
117 |
agaagataagaaagctttcaagaaagtgagtggaaaaaggctaaatagttgtaactatgttctagaaatggaaaggaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34469388 |
agaagataagaaagctttcaagaaagtgagtggaaaaaggctaaatagttgtaactatgttctagaaatggaaaggaag |
34469466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University