View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_64 (Length: 201)
Name: NF21359_low_64
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 26 - 168
Target Start/End: Complemental strand, 45138539 - 45138397
Alignment:
| Q |
26 |
tagagggaggtatattggtgttagttcctgagagattctaatgaggttgttatctgattatcaatgggctactcttctcaagaccatgagaacaaatggt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45138539 |
tagagggaggtatattggtgttagttccagagagattctaatgaggttgttatctgattatcaatgggctactcttctcaagaccatgcgaacaaatggt |
45138440 |
T |
|
| Q |
126 |
ctcgtattttatcatatagataggatatcattgtttttgtcac |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45138439 |
ctcgtattttatcatatagataggatatcattgtttttgtcac |
45138397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University