View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2135_high_2 (Length: 372)
Name: NF2135_high_2
Description: NF2135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2135_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 363
Target Start/End: Complemental strand, 36867173 - 36866829
Alignment:
| Q |
18 |
taatattgctacctcgttggatgtattccatcatttgactccagaggtttcacatcaggttggtatactttcacacaaaacctcttgaaaagaaggttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36867173 |
taatattgctacctcgttggatgtattccatcatttgactccagaggtttcacatcaggttggtatactttcacacaaaacctcttgaaaagaaggttta |
36867074 |
T |
 |
| Q |
118 |
caattgcaattttagtcgcgccatcaaggttactgatgtcaaatatcataatgtgaccgtgattgcgactttgatttagaatctttttgcggggatttgg |
217 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36867073 |
caattgtaattttagtcgcgccgtcaaggtttctgatgtcaaatatcataatgtgaccgtgattgcgactttgatttagaatctttttgcggggatttgg |
36866974 |
T |
 |
| Q |
218 |
attgtctgaagacaacaatcccatgcattcatgcggtaaacatatcgacagttattggattgagatcaaacagttcatatttcaatgcaaatttgattcn |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36866973 |
tttgtctgaagacaacaatcccatgcattcatgcggtcaacatatcgacagttattggattgagatcaaacagttcatatttcaatgcaaatttgatt-t |
36866875 |
T |
 |
| Q |
318 |
nnnnnnaatctaaaataccaatcctcgaaatatggatcgttcaatc |
363 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36866874 |
ttttttaatctaaaataccaattctcgaaatatggatcgttcaatc |
36866829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University