View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2135_low_8 (Length: 264)
Name: NF2135_low_8
Description: NF2135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2135_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 36810200 - 36810446
Alignment:
| Q |
1 |
tgacaatcaccacacttccctttgttcttgaatattgtaaccatcatcttgaggtgccatgatagagaagaacattgtggccatttcttgtatgaaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36810200 |
tgacaatcaccacacttccctttgttcttgaatattgtaaccatcatcttgaggtgccatgatagagaagaacattgtggccatttcttgtatgaaacag |
36810299 |
T |
 |
| Q |
101 |
tactgcatggtgaaatcctagaaactggttgaggaagtttaagtgagggagagagggttatagttgcatgaatgaatgaaatgtgtgggaatgagtagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36810300 |
tactgcatggtgaaatcctagaaactggttgaggaagtttaagtgagggagagagggttatagttgcatgaatgaatgaaatgtgtgggaatgagtagaa |
36810399 |
T |
 |
| Q |
201 |
gaatattggaactatatatataatgaaaactcaagaagagtgtgagg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36810400 |
gaatattggaactatatatataatgaaaactcaagaagattgtgagg |
36810446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University