View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21360_high_4 (Length: 277)
Name: NF21360_high_4
Description: NF21360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21360_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 37959713 - 37959961
Alignment:
| Q |
13 |
aatatatatgtggaaggacccgtcgactcaatgtctcaaggtcctatgtaaatatgtggtatttggttcacttgtgcagttgttcttggttcattgtgat |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37959713 |
aatatatatgtgggaggacccgtcgactcaatgtctcaaggtcctatgtaaatatgtggtatctagttcacttgtgtagttgttcttggttcattgtgat |
37959812 |
T |
 |
| Q |
113 |
aatcccccgtgacccaacattaattaaccatactttcaacttataagaggatctccatcctaaattaaagatatacacacttttccaataaacctttcgc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959813 |
aatcccccgtgacccaacattaattaaccattctttcaacttataagaggatctccatcctaaattaaagatatacacacttttccaataaacctttcgc |
37959912 |
T |
 |
| Q |
213 |
tttactaaattagatactaacttaagatttgttgaattctatatataat |
261 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37959913 |
tttgctaaattagatactaacttaagacttgttgaattctatatataat |
37959961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University