View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21360_high_6 (Length: 237)
Name: NF21360_high_6
Description: NF21360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21360_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 139 - 218
Target Start/End: Original strand, 935062 - 935142
Alignment:
| Q |
139 |
tgaacaatgtagtacttaagacatgaaaatactctgt-ctctaattttttgattcaaaccctcattagttgatgtccttag |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
935062 |
tgaacaatgtagtacttgagacatgaaaatactctgttctctaattttttgactcaaaccctcattagttgatgtccttag |
935142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 934937 - 934981
Alignment:
| Q |
15 |
aaaatatcaataaaattaggttccttcaaagttatggaagatttg |
59 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
934937 |
aaaaaatcaataaaattaggttccttcaaagttatggaaaatttg |
934981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University