View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21360_low_5 (Length: 263)
Name: NF21360_low_5
Description: NF21360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21360_low_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 44017225 - 44016987
Alignment:
| Q |
19 |
gtgctctcctaaactagtagtcttttattaccttcaccttcaccttcaccctcatcttctacattaatctccgactccaagtaaagccaccattttcaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
44017225 |
gtgctctcctaaactagtagtcttttat------caccttcaccttcaccctcatcttctacattaatctccaactccaagtaaagtcaccattttcaca |
44017132 |
T |
 |
| Q |
119 |
atcaaaaatggaaaatattagtgttacctctttgttcttttgcttactcttttttagcataacaaagatacaagtaataacttctctttcacctgatgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017131 |
atcaaaaatggaaaatattagtgttacctctttgttcttttgcttactcttttttagcataacaaagatacaagtaataacttctctttcacctgatgga |
44017032 |
T |
 |
| Q |
219 |
caagcacttctttctcttgcaacatcatcaccttctattctctct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44017031 |
caagcacttctttctcttgcaacatcatcaccttctattctctct |
44016987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University