View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21361_high_13 (Length: 205)

Name: NF21361_high_13
Description: NF21361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21361_high_13
NF21361_high_13
[»] chr2 (1 HSPs)
chr2 (50-187)||(41247053-41247190)
[»] chr4 (2 HSPs)
chr4 (50-187)||(10707646-10707783)
chr4 (50-187)||(10921416-10921553)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 41247190 - 41247053
Alignment:
50 tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
41247190 tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacaccgcttcagcactattttctatcttcg 41247091  T
150 gtgtggggcagtattaaggaacacttgtctactatttc 187  Q
     |||||||| ||||||||||||||||||||||||||||    
41247090 atgtggggcggtattaaggaacacttgtctactatttc 41247053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 10707783 - 10707646
Alignment:
50 tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg 149  Q
    |||||||||||||||||||| ||||||  ||||||||| |||  |||  || |  ||||||||||||| ||||| ||||||||||||||||| ||||| |    
10707783 tgcttggcaattctcaacgggagattcaaaatgggcagggctattgcgacatatatttctcaagcatgacacaccgcttcagcactattttcaatctttg 10707684  T
150 gtgtggggcagtattaaggaacacttgtctactatttc 187  Q
    ||||||||| ||||||| ||||||||| ||||| ||||    
10707683 gtgtggggcggtattaaagaacacttggctactgtttc 10707646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 10921553 - 10921416
Alignment:
50 tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg 149  Q
    |||||||||||||||||||| ||||||  ||||||||| |||  |||  || |  ||||||||||||| ||||| ||||||||||||||||| ||||| |    
10921553 tgcttggcaattctcaacgggagattcaaaatgggcagggctattgcgacatatatttctcaagcatgacacaccgcttcagcactattttcaatctttg 10921454  T
150 gtgtggggcagtattaaggaacacttgtctactatttc 187  Q
    ||||||||| ||||||| ||||||||| ||||| ||||    
10921453 gtgtggggcggtattaaagaacacttggctactgtttc 10921416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University