View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21361_low_16 (Length: 205)
Name: NF21361_low_16
Description: NF21361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21361_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 41247190 - 41247053
Alignment:
| Q |
50 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41247190 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacaccgcttcagcactattttctatcttcg |
41247091 |
T |
 |
| Q |
150 |
gtgtggggcagtattaaggaacacttgtctactatttc |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41247090 |
atgtggggcggtattaaggaacacttgtctactatttc |
41247053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 10707783 - 10707646
Alignment:
| Q |
50 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg |
149 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| ||| ||| || | ||||||||||||| ||||| ||||||||||||||||| ||||| | |
|
|
| T |
10707783 |
tgcttggcaattctcaacgggagattcaaaatgggcagggctattgcgacatatatttctcaagcatgacacaccgcttcagcactattttcaatctttg |
10707684 |
T |
 |
| Q |
150 |
gtgtggggcagtattaaggaacacttgtctactatttc |
187 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||| |||| |
|
|
| T |
10707683 |
gtgtggggcggtattaaagaacacttggctactgtttc |
10707646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 50 - 187
Target Start/End: Complemental strand, 10921553 - 10921416
Alignment:
| Q |
50 |
tgcttggcaattctcaacggcagattctcaatgggcagcgctgatgcatcacaggtttctcaagcatggcacactgcttcagcactattttctatcttcg |
149 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| ||| ||| || | ||||||||||||| ||||| ||||||||||||||||| ||||| | |
|
|
| T |
10921553 |
tgcttggcaattctcaacgggagattcaaaatgggcagggctattgcgacatatatttctcaagcatgacacaccgcttcagcactattttcaatctttg |
10921454 |
T |
 |
| Q |
150 |
gtgtggggcagtattaaggaacacttgtctactatttc |
187 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||| |||| |
|
|
| T |
10921453 |
gtgtggggcggtattaaagaacacttggctactgtttc |
10921416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University