View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21362_low_6 (Length: 328)
Name: NF21362_low_6
Description: NF21362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21362_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 42533834 - 42534062
Alignment:
| Q |
19 |
ctagtcgcctcaaactattgatgttcatttacggtaatggaggtatttcagtctctttatatgcaattatggtgatggttgtaggtttggaagttgcaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42533834 |
ctagtcgcctcaaactattgatgttcatttacggtaatggaggtatttcagtctctttatatcccattatggtgatggttgtaggtttggaagtggcaga |
42533933 |
T |
 |
| Q |
119 |
agtggatggtgtattttgagcttagagcttggcaagcttttcctttctctttttcttg-tgtttactctaccttccatacaattctttgctaaattttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42533934 |
agtggatggtgtattttgagcttagagcttggcaagcttttcctttctctttttcttgttgtttactctaccttccatacaattctttgctaaatttttt |
42534033 |
T |
 |
| Q |
218 |
cccaaatgtcagtatcagggttagttttc |
246 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
42534034 |
cccaaatgtcaatatcagggttagttttc |
42534062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University