View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21363_low_5 (Length: 238)
Name: NF21363_low_5
Description: NF21363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21363_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 32514053 - 32514258
Alignment:
| Q |
18 |
tattaatcgtttgattaggggatcatttttatccttccatgttttcggttttgttaaccctctaattgaaatgagatttcagtgttcatttttggtcggg |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||| ||| |
|
|
| T |
32514053 |
tattaatcgtttgataaggggatcatttttatccttccatgttttctgttttgttaaccctctaattaaaatgagatttcagtgttcattttcggttggg |
32514152 |
T |
 |
| Q |
118 |
atgtaagtaaaaaccttttgaaggattcgtccttattgatatggcaagtgtgagtaacagtctcataatagataaattgatgcctacaagtttaagataa |
217 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
32514153 |
atgtaagtaaaaatctttcgaaggattcgtccttattgatatggtaagtgtgagtaacagtctcataatagatgaattgatgcctacgagtttaagataa |
32514252 |
T |
 |
| Q |
218 |
gatgtg |
223 |
Q |
| |
|
|||||| |
|
|
| T |
32514253 |
gatgtg |
32514258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University