View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21364_high_11 (Length: 318)
Name: NF21364_high_11
Description: NF21364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21364_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 194 - 299
Target Start/End: Original strand, 15969190 - 15969295
Alignment:
| Q |
194 |
tgccaggcgtgcttatcactaacggcaaccaacatacaaaaactcttctcttccaatccaaccccacactacttagatacacctcacatatgaactgtaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15969190 |
tgccaggcgtgcttatcactaacggcaaccaacatacaaaaactcttctcttccaatccaaccccacactacttagatacacctcacatatgaactgtaa |
15969289 |
T |
 |
| Q |
294 |
atttgc |
299 |
Q |
| |
|
|||||| |
|
|
| T |
15969290 |
atttgc |
15969295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University