View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21364_high_13 (Length: 294)
Name: NF21364_high_13
Description: NF21364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21364_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 278
Target Start/End: Complemental strand, 50229435 - 50229167
Alignment:
| Q |
10 |
gcataggtgagggtggggagtggatgtgcagaggtggagaaggcgtctttttacttaggaggcggcnnnnnnnacaggttaacatggttgattgatgact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50229435 |
gcataggtgagggtggggagtggatgtgcagaggtggagaaggcgtctttttacttaggaggcggctttttttacaggttaacatggttgattgatgact |
50229336 |
T |
 |
| Q |
110 |
ttggttacttaatctgtctaacggatattcagtcaaagatgcttatcaaactcataagcatgtgatcaacccaacttagatannnnnnnctcatttggtt |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50229335 |
ttggttacttagtctgtctaacggatattcagtcaaagatgcttatcaaactcataagcatgtgatcaacccaacttagatatttttttctcatttggtt |
50229236 |
T |
 |
| Q |
210 |
tggaacaaaactaaactatgaagatatcattatatatggaggctcttgaacaaaaggattcctactaag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229235 |
tggaacaaaactaaactatgaagatatcattatatatggaggctcttgaacaaaaggattcctactaag |
50229167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University