View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21364_high_16 (Length: 239)
Name: NF21364_high_16
Description: NF21364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21364_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 2064214 - 2064011
Alignment:
| Q |
18 |
tgaaccggttgattatgacgttgaaggtaacagaattggtgaagaaattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064214 |
tgaaccggttgattatgacgttgaaggtaacagaattggtgaagagattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaac |
2064115 |
T |
|
| Q |
118 |
atttaggtttataaatttcgatataannnnnnnnnnnnnaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggct |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064114 |
atttaggtttataaatttcgatataatttttttatttttaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggct |
2064015 |
T |
|
| Q |
218 |
ttag |
221 |
Q |
| |
|
|||| |
|
|
| T |
2064014 |
ttag |
2064011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University