View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21364_high_9 (Length: 327)
Name: NF21364_high_9
Description: NF21364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21364_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 164 - 312
Target Start/End: Complemental strand, 2445765 - 2445617
Alignment:
| Q |
164 |
tccctacatctgaatgtatactcactatctcttaattttctaatcacctctctctccacacttttgttttaccggagaggcatgataaaaaagagaaaat |
263 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2445765 |
tccctacatctgaatgtatcctcactatctcttaattttctaatcacctctctctccacacttttgttttaccggagaggcatgataaaaaagagaaaat |
2445666 |
T |
 |
| Q |
264 |
gtgttctattatgtttttatttttgaaggatattttatcatgttatatg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2445665 |
gtgttctattatgtttttatttttgaaggatattttatcatgttatatg |
2445617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 2446156 - 2446033
Alignment:
| Q |
1 |
ataatgtttgacaagcaggtcagaacacatcagnnnnnnncaagctctttctgtatatcaatagtaaaacaggattacaagaaaaggatgtgatgtatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446156 |
ataatgtttgacaagcaggtcagaacacatcagtttttttcaagctctttctgtatatcaatagtaaaacaggattacaagaaaaggatgtgatgtatta |
2446057 |
T |
 |
| Q |
101 |
agtttttgtctttactacttgagc |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2446056 |
agtttttgtctttactacttgagc |
2446033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 117 - 167
Target Start/End: Original strand, 2446257 - 2446307
Alignment:
| Q |
117 |
acttgagcttggaaaatgggtggaatcatatgttgagaagaaaaatatccc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446257 |
acttgagcttggaaaatgggtggaatcatatgttgagaagaaaaatatccc |
2446307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University