View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21364_low_21 (Length: 239)

Name: NF21364_low_21
Description: NF21364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21364_low_21
NF21364_low_21
[»] chr8 (1 HSPs)
chr8 (18-221)||(2064011-2064214)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 2064214 - 2064011
Alignment:
18 tgaaccggttgattatgacgttgaaggtaacagaattggtgaagaaattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2064214 tgaaccggttgattatgacgttgaaggtaacagaattggtgaagagattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaac 2064115  T
118 atttaggtttataaatttcgatataannnnnnnnnnnnnaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggct 217  Q
    ||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2064114 atttaggtttataaatttcgatataatttttttatttttaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggct 2064015  T
218 ttag 221  Q
    ||||    
2064014 ttag 2064011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University