View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21364_low_24 (Length: 216)
Name: NF21364_low_24
Description: NF21364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21364_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 39075758 - 39075581
Alignment:
| Q |
19 |
atgaagcacaaaatcaacaatgtgaagtttcgtctcatcgaatcttccactttagtaaggaacaaattctgcaactcaaatcaaaagctaatgcagaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075758 |
atgaagcacaaaatcaacaatgtgaagttttgtctcatcgaatcttccactttagtaaggaacaaattctgcaactcaaatcaaaagctaatgcagaaat |
39075659 |
T |
 |
| Q |
119 |
ccnnnnnnnnnnnnnnnnnnnngagaaaataataatatcttcactgcaagcgcttttaagtcacgtttggcgtttaattat |
199 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075658 |
c---agtagtagtaatagtagtgagaaaataataatatcttcattgcaagcgcttttaagtcacgtttggcgtttaattat |
39075581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 24 - 118
Target Start/End: Complemental strand, 7399011 - 7398917
Alignment:
| Q |
24 |
gcacaaaatcaacaatgtgaagtttcgtctcatcgaatcttccactttagtaaggaacaaattctgcaactcaaatcaaaagctaatgcagaaat |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7399011 |
gcacaaaatcaacaatgtgatgtttcgtctaatcgaatcttccactttactaaagaacaaattctgcaactcaaatcaaaagctaatgcagaaat |
7398917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 153 - 199
Target Start/End: Complemental strand, 7398876 - 7398830
Alignment:
| Q |
153 |
atatcttcactgcaagcgcttttaagtcacgtttggcgtttaattat |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
7398876 |
atatcttcattgcaagcgcttttaagtcacctttggcgtttatttat |
7398830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 52 - 118
Target Start/End: Complemental strand, 34174625 - 34174559
Alignment:
| Q |
52 |
ctcatcgaatcttccactttagtaaggaacaaattctgcaactcaaatcaaaagctaatgcagaaat |
118 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34174625 |
ctcatcgaatcttccacttcacaaaggaacaaattctgcaactcaaatcaaaagctaatgcagaaat |
34174559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 195
Target Start/End: Complemental strand, 34174536 - 34174485
Alignment:
| Q |
144 |
aaaataataatatcttcactgcaagcgcttttaagtcacgtttggcgtttaa |
195 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||| |||||||||||| |
|
|
| T |
34174536 |
aaaataataatatcttcattgcaagcacttttaagccacttttggcgtttaa |
34174485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University