View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21365_high_2 (Length: 314)

Name: NF21365_high_2
Description: NF21365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21365_high_2
NF21365_high_2
[»] chr3 (1 HSPs)
chr3 (223-297)||(49472634-49472709)


Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 297
Target Start/End: Original strand, 49472634 - 49472709
Alignment:
223 gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaa-ccccccgacaccgacttggttc 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
49472634 gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaacccccccgacaccgacttggttc 49472709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University