View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21365_high_2 (Length: 314)
Name: NF21365_high_2
Description: NF21365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21365_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 297
Target Start/End: Original strand, 49472634 - 49472709
Alignment:
| Q |
223 |
gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaa-ccccccgacaccgacttggttc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49472634 |
gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaacccccccgacaccgacttggttc |
49472709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University