View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21366_low_2 (Length: 714)
Name: NF21366_low_2
Description: NF21366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21366_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 562 - 699
Target Start/End: Complemental strand, 7131381 - 7131244
Alignment:
| Q |
562 |
ttctcaatggttatatatagtcgtgttttctctatatcgatgatttatctttgttgtattgcttttccaatgtaaaactctgagattaacattttgattt |
661 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7131381 |
ttctcaatggttatatatagtcgtgttttctctatatcgatgatttatctttgttgtattgcttttccaatgtaaaactctgaaattaacattttgattt |
7131282 |
T |
 |
| Q |
662 |
taataagttcttgtacaccgaggataaattcatctgtg |
699 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7131281 |
taataagttcttgtacaccgaggataaattcatctgtg |
7131244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 117
Target Start/End: Original strand, 4608511 - 4608550
Alignment:
| Q |
78 |
aaacaaagttctaagttagggagggttgataagtgccaaa |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4608511 |
aaacaaagttctaagttggggagggttgataagtgtcaaa |
4608550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 119
Target Start/End: Original strand, 5450701 - 5450746
Alignment:
| Q |
74 |
ggacaaacaaagttctaagttagggagggttgataagtgccaaaat |
119 |
Q |
| |
|
||||||||| |||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
5450701 |
ggacaaacagagttataagttggggagcgttgataagtgccaaaat |
5450746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University