View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21366_low_20 (Length: 228)
Name: NF21366_low_20
Description: NF21366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21366_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 205
Target Start/End: Original strand, 8542314 - 8542509
Alignment:
| Q |
10 |
atgtcgaagaaaataggaatacggcataatcaagagggtgtcgattgtaggaagtagtgtttcagctaaccaaccaacacatttagctagatttgatgct |
109 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8542314 |
atgtccaacaaaataggaatacggcataatcaagagggtgtcaattgtaggaagtagtgtttcagctaaccaaccaacacatttagctagatttgatgct |
8542413 |
T |
 |
| Q |
110 |
tttgagcattttttaaatgagaaactccaatagatcataaaaatgagattgagaggtatttggatgaagacaacatgaatggagacaataagttta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8542414 |
tttgagcattttttaaatgagaaactccaatagatcataaaaatgagattgagaggtatttggatgaagacaacatgaatggagacaataagttta |
8542509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 8543255 - 8543213
Alignment:
| Q |
148 |
aaaaatgagattgagaggtatttggatgaagacaacatgaatg |
190 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8543255 |
aaaaatgagattgagtggtatttggatgaagacaacatgaatg |
8543213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University