View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21366_low_24 (Length: 202)
Name: NF21366_low_24
Description: NF21366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21366_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 5744584 - 5744451
Alignment:
| Q |
1 |
aatttatactctaaagctaataacagaaattaggtacccaaaaaatcagcaacggttctgccattggaaaatcttcccgttggacctctagggaaatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5744584 |
aatttatactctaaagctaataacagaaattaggtacccaaaaaatcggcaacggttctgccattggaaaatcttcccgttggacctctagggaaatcaa |
5744485 |
T |
|
| Q |
101 |
ctccataaggtaagaaatttgctctcgctaaagt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5744484 |
ctccataaggtaagaaatttgctctcgctaaagt |
5744451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University