View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21367_low_9 (Length: 363)
Name: NF21367_low_9
Description: NF21367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21367_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 46913385 - 46913731
Alignment:
| Q |
1 |
tatttctacgacaccacggagcttccaccacctgacttttcttccgtcttcgcctcccaacggttcttcttctcctccccaggcagctccaattccatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913385 |
tatttctacgacaccacggagcttccaccacctgacttttcttccgtcttcgcctcccaacggttcttcttctcctccccaggcagctccaattccatca |
46913484 |
T |
|
| Q |
101 |
cagagtctccctccaacgacactctaccctgtaataactcgttgataccaagaggaggtagtgtgaagagggtgccaaaatattctgtaaacccttacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913485 |
cagagtctccctccaacgacactctaccctgtaataactcgttgataccaagaggaggtagtgtgaagagggtgccaaaatattctgtaaacccttacgt |
46913584 |
T |
|
| Q |
201 |
tgatttcctccgttctatgcaggaaatgattcaatctcaacaacaagtggttgatgttactaatgattgggattatcttcatgaacttctcttatgctat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913585 |
tgatttcctccgttctatgcaggaaatgattcaatctcaacaacaagtggtggatgttactaacgattgggattatcttcatgaacttctcttatgctat |
46913684 |
T |
|
| Q |
301 |
cttgctcttaatcctacacatactcacaagtatattgttcaagcttt |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913685 |
cttgctcttaatcctacacatactcacaagtatattgttcaagcttt |
46913731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University