View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21368_high_7 (Length: 213)
Name: NF21368_high_7
Description: NF21368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21368_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 34959926 - 34959873
Alignment:
| Q |
139 |
ccaggtaccggtaatgtactaccatcttacattatagtgccagggcagatatga |
192 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34959926 |
ccaggtactggtaatgtactaccatcttacattatagtgccagggcagatatga |
34959873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 198
Target Start/End: Complemental strand, 34955917 - 34955822
Alignment:
| Q |
107 |
gcgtcatttacttttgcagtcttggatgcaaaccaggtac----cggtaatgtactaccatcttacattatagtgccagggcagatatgataccat |
198 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||| |||||||||||||||||| | ||| ||||| |||||||| ||||||||||| |
|
|
| T |
34955917 |
gcgtcatttacttttgtagtcttgcctgcgaaccaggtactgataggtaatgtactaccatctcatattgtagtgtcagggcaggtatgataccat |
34955822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University