View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21369_high_10 (Length: 206)

Name: NF21369_high_10
Description: NF21369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21369_high_10
NF21369_high_10
[»] chr2 (2 HSPs)
chr2 (1-82)||(38940200-38940281)
chr2 (148-194)||(38940347-38940393)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 38940200 - 38940281
Alignment:
1 ttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc 82  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38940200 ttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc 38940281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 38940347 - 38940393
Alignment:
148 gtctgcacttgatatactgtatgaatattttggtttctatttctgat 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
38940347 gtctgcacttgatatactgtatgaatattttggtttctatttctgat 38940393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University