View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21369_high_9 (Length: 246)
Name: NF21369_high_9
Description: NF21369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21369_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 21194521 - 21194288
Alignment:
| Q |
1 |
gcactaactgtatcaacaaatgaagcattttccattccaaaaatatttgaacctgacataaatttctgagccaaaaagggttgaaggaggttaaactgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21194521 |
gcactaactgtatcaacaaatgaagcattttccattccaaaaatatttgaacctgacataaatttctgagccaaaaagggatgaaggaggttaaactgtc |
21194422 |
T |
|
| Q |
101 |
cttgttgtagttgtttttgtgaggaattattgatagcttcttcagtgagatctaatgtgatagttggaaatggagctgaagctgagagtgttgccatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21194421 |
cttgttgtagttgtttttgtgaggaattattgatagcttcttcagttagatctaacgtgatagttggaaatggagctgaagctgagagtgttgccatggt |
21194322 |
T |
|
| Q |
201 |
gtgtgaacaagggagtgatccactttctaatatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21194321 |
gtgtgaacaagggagtgatccactttctaatatt |
21194288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 145 - 198
Target Start/End: Original strand, 8496777 - 8496830
Alignment:
| Q |
145 |
gtgagatctaatgtgatagttggaaatggagctgaagctgagagtgttgccatg |
198 |
Q |
| |
|
|||||||||||||| | ||| |||||||| ||||||||||| ||||| |||||| |
|
|
| T |
8496777 |
gtgagatctaatgtaacagtaggaaatggtgctgaagctgaaagtgtagccatg |
8496830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University