View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21369_low_11 (Length: 206)
Name: NF21369_low_11
Description: NF21369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21369_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 38940200 - 38940281
Alignment:
| Q |
1 |
ttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940200 |
ttcactcactgatgaatcttcgttccgtttcaggttttagctcgaacatcttctcggtaattcgtcatcgctatttcttctc |
38940281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 194
Target Start/End: Original strand, 38940347 - 38940393
Alignment:
| Q |
148 |
gtctgcacttgatatactgtatgaatattttggtttctatttctgat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940347 |
gtctgcacttgatatactgtatgaatattttggtttctatttctgat |
38940393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University