View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2136_high_4 (Length: 338)
Name: NF2136_high_4
Description: NF2136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2136_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 272
Target Start/End: Original strand, 1224466 - 1224722
Alignment:
| Q |
16 |
attctttcagctaccgttgatctttcggagtattttcgcgataatgaagctgtttatgttggtttttcagcttctgctgaaaaaagtactgagcttcatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224466 |
attctttcagctaccgttgatctttcggggtattttcgcgataatgaagctgtttatgttggtttttcagcttctgctgaaaaaagtactgagcttcatc |
1224565 |
T |
|
| Q |
116 |
aaattgaaagatggagtttttacactgttgggtttgagcctgcaagacctaggttgcctagtcacaatgtttccgataattctgttggtgtaagtaccgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224566 |
aaattgaaagatggagtttttacactgttgggtttgagcctgcaagacctaggttgcgtagtcacaatgtttccgataattctgttggtgtaagtaccgg |
1224665 |
T |
|
| Q |
216 |
gaatgaggtaaaagtctgtgggtcgcgttcttctttttcttcgtcttcgaagaaaaa |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224666 |
gaatgaggtaaaagttcgtgggtcgcgttcttctttttcttcgtcttcgaagaaaaa |
1224722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 41962992 - 41963234
Alignment:
| Q |
16 |
attctttcagctaccgttgatctttcggagtattttcgcgataatgaagctgtttatgttggtttttcagcttctgctgaaaaaagtactgagcttcatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41962992 |
attctttcagctaccgttgatctttcggagtatttttgtgataatgaagctgtttatgttggtttttcagcttctgctgaaaaaagtactgagcttcatc |
41963091 |
T |
|
| Q |
116 |
aaattgaaagatggagtttttacactgttgggtttgagcctgcaagacctaggttgcctagtcacaatgtttccgataattctgttggtgtaagtaccgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41963092 |
aaattgaaagatggagtttttacactgttgggtttgagcctgcaagacctaggttgcgtagtcacaatgtttccgataattctgttggtgtaagtaccgg |
41963191 |
T |
|
| Q |
216 |
gaatgaggtaaaagtctgtgggtcgcgttcttctttttcttcg |
258 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41963192 |
gaatgaggtaaaagttcgtgggtcgcgttctactttttcttcg |
41963234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University