View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21370_high_10 (Length: 240)
Name: NF21370_high_10
Description: NF21370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21370_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 23522280 - 23522494
Alignment:
| Q |
8 |
gtgggtagataatactattgagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc |
107 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522280 |
gtgggtatatactactatagagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc |
23522379 |
T |
|
| Q |
108 |
ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgtccatccatagatgtaatgtaagagtccccaccttttccttcccctctctg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522380 |
ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgtccatccatagatgtaatgtaagagtccccaccttttccttcccctctctg |
23522479 |
T |
|
| Q |
208 |
ttttataggtcccac |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23522480 |
ttttataggtcccac |
23522494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University