View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21370_high_11 (Length: 219)
Name: NF21370_high_11
Description: NF21370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21370_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 8388338 - 8388488
Alignment:
| Q |
5 |
gcacctaactttagcttaacccatgcttgaaaatggaacatttctcacataatctctct---------aaaacaggattgtttgcgggatgctgatgccc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8388338 |
gcacctaactttagcttaacccatgcttgaaaatggaacatttctcacataatctctctgttgggagtaaaacaggattgtttgcgggatgctgatgccc |
8388437 |
T |
 |
| Q |
96 |
aaatggtggttaaagtgataatttggaagccttgaagaaactattaccatg |
146 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8388438 |
aaatggtggttaaagtgataatttgggagccttgaagaaactattaccatg |
8388488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University