View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21370_low_6 (Length: 409)
Name: NF21370_low_6
Description: NF21370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21370_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 4 - 233
Target Start/End: Complemental strand, 34051695 - 34051466
Alignment:
| Q |
4 |
agatttattgttcttttgaagtttataaatgcctatatccatagcaatttcatatagacatatggcctaagagactatcaactagcaagcaactatctac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34051695 |
agatttattgttcttttgaagtttataaatgcctatatccatagcaatttcatatagacatatggcctaagagactatcaactagcaagcaactatctac |
34051596 |
T |
|
| Q |
104 |
aataggaagtaaatacattaattgggtgaagagctgaatacatattacttaaacgtaagatgcatgaactactttcaaggctattaatattggacttgat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34051595 |
aataggaagtaaatacattaattgggtgaagagctgaatacatattacttaaacgtaagatgcatgaactactttcaaggctattaatattggacttgat |
34051496 |
T |
|
| Q |
204 |
aaacaaattgtttttctatttcttatatcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34051495 |
aaacaaattgtttttctatttcttatatcc |
34051466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University