View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21371_low_10 (Length: 235)
Name: NF21371_low_10
Description: NF21371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21371_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 40115987 - 40115844
Alignment:
| Q |
19 |
ttatttaggtgtatccatgaaatattttcttnnnnnnn-gtgtgcaagaaacattgtgactagtagcactagggaaacatagaaaagggtaatgatagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115987 |
ttatttaggtgtatccatgaaatattttcttaaaaaaaagtgtgcaagaaacattgtgactagtagcactagggaaacatagaaaagggtaatgatagaa |
40115888 |
T |
|
| Q |
118 |
gttgtttgttgaagcggagaggtcaagtaactgtaaaatagcag |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115887 |
gttgtttgttgaagcggagaggtcaagtaactgtaaaatagcag |
40115844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University