View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21372_high_15 (Length: 334)
Name: NF21372_high_15
Description: NF21372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21372_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 28 - 330
Target Start/End: Complemental strand, 6027214 - 6026911
Alignment:
| Q |
28 |
catcatcaacaagatttttgcttcagccgttaaagaacttccacagcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027214 |
catcatcaacaagatttttgcttcagccgttaaagaacttccacggcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt |
6027115 |
T |
|
| Q |
128 |
-aatcgattcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagca |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027114 |
taatcgattcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagca |
6027015 |
T |
|
| Q |
227 |
aaatcaccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaaggtgatgatgattatgattatgac |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027014 |
aaatcaccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaaggtgatgatgattatgattatgac |
6026915 |
T |
|
| Q |
327 |
tatg |
330 |
Q |
| |
|
|||| |
|
|
| T |
6026914 |
tatg |
6026911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University