View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21373_low_13 (Length: 345)
Name: NF21373_low_13
Description: NF21373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21373_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 44404931 - 44405262
Alignment:
| Q |
1 |
tggtgtctgttggcaacaagatgggacccacaaagtctggggaagatggttcttcgacttataaggtttcatgggttccagatcctgtcactggttacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44404931 |
tggtgtctgttggcaacaagatgggacccacaaagtctggggaagatggttcttcgacttataaggtttcatgggttccagatcctgtcactggttacta |
44405030 |
T |
 |
| Q |
101 |
caagcctgagaatattaaggatactgatgccgctgatttacgtgctaagcttctccgcaaaaaatttaacaactaatttcaatccattcaagaaatagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44405031 |
caagcctgagaatattaaggatactgatgccgctgatttacgtgctaagcttctccgcaaaaaatttaacaactaatttcaatccattcaagaaatagat |
44405130 |
T |
 |
| Q |
201 |
ttatattatgtattttgggtttgttatttcaaccgcggatctcatgagcttttggggtcgattgtagatggcttattaaagccttgattgattctgttaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44405131 |
ttatattatgtattttgggtttgttatttcaaccgcggatctcatgagcttttggggtcgattgtagatggcttattaaagccttgattgattctgttaa |
44405230 |
T |
 |
| Q |
301 |
ttgcgaagatcctactctgttggtttattcct |
332 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
44405231 |
ttgtgaagatcctactctgttggtttattcct |
44405262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 44414608 - 44414789
Alignment:
| Q |
1 |
tggtgtctgttggcaacaagatgggacccacaaagtctggggaagatggttcttcgacttataaggtttcatgggttccagatcctgtcactggttacta |
100 |
Q |
| |
|
||||||||| || ||||||| |||| |||| ||||| ||||||| ||| ||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44414608 |
tggtgtctgccggaaacaagacgggagccacgaagtcaagggaagaaggtgtttctgcttataaggtttcatgggttccagatccagtcactggttacta |
44414707 |
T |
 |
| Q |
101 |
caagcctgagaatattaaggatactgatgccgctgatttacgtgctaagcttctccgcaaaaaatttaacaactaatttcaa |
182 |
Q |
| |
|
| ||||||||| |||||||||| |||||| ||||| |||||||||||||||| || ||||||||| |||||||||| |||| |
|
|
| T |
44414708 |
taggcctgagaacattaaggatattgatgctgctgaattacgtgctaagcttccccccaaaaaattcaacaactaatctcaa |
44414789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University