View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21374_high_12 (Length: 243)
Name: NF21374_high_12
Description: NF21374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21374_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 23335575 - 23335514
Alignment:
| Q |
15 |
tatgtagaaccttgtaccaaatcttgggtgcaaattcaaacccacaattttaaagcacttta |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23335575 |
tatgtagaaccttgtacaaaatcttgggtgcaaattcaaacccacaattttcaagcacttta |
23335514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University