View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21374_high_13 (Length: 241)
Name: NF21374_high_13
Description: NF21374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21374_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 48115194 - 48114985
Alignment:
| Q |
11 |
aataagataggacatgaaaataagagtatggaagaaaagaagaattcacattttacatttaggtttttgtaaaagttgagataggttcaatatcgagctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48115194 |
aataagataggacatgaaaataagagtatggaagcaaagaagaattctcattttacatgtaggtttttgtaaaagttgagataggttcaatatcgagctt |
48115095 |
T |
 |
| Q |
111 |
tattcaaaatccgttcagttcacgattatcgaaccaatcatacaacgttgtagatgtttagtccataagtggtggatagccaccgcctttgttatcatat |
210 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48115094 |
tattcaaaatccgtttaattcacgattatcgaaccaatcatacaacgtttgagatgtttagtccataagtggtggatagccaccgcctttgttatcatat |
48114995 |
T |
 |
| Q |
211 |
tactactatc |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
48114994 |
tactactatc |
48114985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University