View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21374_high_6 (Length: 296)
Name: NF21374_high_6
Description: NF21374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21374_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 4 - 237
Target Start/End: Original strand, 21944629 - 21944862
Alignment:
| Q |
4 |
tgcagcaattttggtgcatagatggttacctgggtcaagagtgttgaagaaatcggtgcatttatgtcttcaaggggtggctttagcttctgggatattt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21944629 |
tgcagcaattttggtgcatagatggttacctggatcaagagggttgaagaaatcggtgcatttatgtcttcaaggggtggctttagcttctgggatattt |
21944728 |
T |
 |
| Q |
104 |
gggatttggacaaaattccaagtaaatgatgggattgtggctaatttctacagtctgcattcatggatgggtttgatttgtgtatcactctttggagctc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21944729 |
gggatttggacaaaattccaagtaaatgatgggattgtggctaatttctacagtctgcattcatggatgggtttgatttgtgtatcactctttggagctc |
21944828 |
T |
 |
| Q |
204 |
aggtgggtattctctatcatttctttacattttt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21944829 |
aggtgggtattctctatcatttctttacattttt |
21944862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University