View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21375_high_10 (Length: 301)
Name: NF21375_high_10
Description: NF21375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21375_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 20 - 291
Target Start/End: Complemental strand, 7177062 - 7176791
Alignment:
| Q |
20 |
aaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttacacatgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177062 |
aaatgcatgtccacgaaaaggcgattcaaaatcaatccgaggttacacatgtaacggcaaaactcaaacatgccaagcatacctcaccttcagaactcaa |
7176963 |
T |
|
| Q |
120 |
ccaatttactcctcagtttcaacaatatcatcattactaggctcaaatccatctcaactcgccgaaataaactccgtttctttaaacgaaacattcgaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7176962 |
ccaatttactcctcagtttcaacaatatcatcattactaggctcaaatccatctcaactcgccgaaataaactccgtttctttaaacgaaacattcgaaa |
7176863 |
T |
|
| Q |
220 |
caaacaaaatggtaattgttcctgtcaattgttcttgttctggtaactattatcaagcaaatacatcctatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7176862 |
caaacaaaatggtaattgttcctgtcaattgttcttgttctggtaactattatcaagcaaatacatcctatg |
7176791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University