View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21375_high_9 (Length: 368)
Name: NF21375_high_9
Description: NF21375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21375_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 46736901 - 46737263
Alignment:
| Q |
1 |
ttatgggatactcaatgtgtcgtctatgcattcatgactcatgagcattgatatctcttgttttgttgtttgagagattggatgtgtgctatgggataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46736901 |
ttatgggatactcaatgtgtcgtctatgcattcatgactcatgagcattgatatctcttgttttgttgtttgagagattggatgtgtgctatgggataaa |
46737000 |
T |
 |
| Q |
101 |
aggagcaattgttttttgaacagaacgtggatgaatgctatatcaacaggggatgttgttgctcatagaaaaccatgtatggatcatgatcacattccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46737001 |
aggagcaattgttttttgaacagaacgtggatgaatgctatatcaacaggggatgttgttgctcatagaaaaccatgtatggatcatgatcgcattccat |
46737100 |
T |
 |
| Q |
201 |
attaatgaaggcatctgcactaccattagtttcacggtacacatgacacactctaacttcacaatctgtttgaagtatccgacgaatatgttgcactagc |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737101 |
attaatgaaggcatctgcacaaccattagcttcacggtacacatgacacactctaacttcacaatctgtttgaagtatccgacgaatatgttgcactagc |
46737200 |
T |
 |
| Q |
301 |
ctccaccaatctgtcaacactgtattaggatcaagaatattttcagctaccacctttgcttct |
363 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737201 |
ctccaccaatctgtctacactgtattaggatcaagaatattttcagctaccacctttgcttct |
46737263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University