View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21376_high_13 (Length: 240)
Name: NF21376_high_13
Description: NF21376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21376_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 9063884 - 9064091
Alignment:
| Q |
20 |
cggaactggtgctcatggaagcacattgtcggggaaaggaagtgcggttcatgactatgttgtcgagataaggatcgttaggccttcggattctgacgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9063884 |
cggaactggtgctcatggaagcacattgtcggggaaaggaagtgcggttcatgactatgttgtcgagataaggatcgttaggccttcggattctgacgat |
9063983 |
T |
|
| Q |
120 |
ggatatgctaaagttgagattcttaatgaacaaaacaatgaagattttaatgcagctaaagtatcacttggtgtgcttggtgttatttcacaggtatgtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9063984 |
ggatatgctaaagttgagattcttaatgaacaaaacaatgaagattttaatgcagctaaagtatcacttggtgtgcttggtgttatttcacaggtatgtt |
9064083 |
T |
|
| Q |
220 |
gttagaaa |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
9064084 |
gttagaaa |
9064091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 29 - 215
Target Start/End: Original strand, 9057769 - 9057955
Alignment:
| Q |
29 |
tgctcatggaagcacattgtcggggaaaggaagtgcggttcatgactatgttgtcgagataaggatcgttaggccttcggattctgacgatggatatgct |
128 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |||||||| ||||||||||| ||||| ||||| |||| ||| |||||||||||| |
|
|
| T |
9057769 |
tgctcatggaagcacattgtgggggaaaggaagttatgttcatgattatgttgtggagataaggattgttagaccttcagattatgaagatggatatgct |
9057868 |
T |
|
| Q |
129 |
aaagttgagattcttaatgaacaaaacaatgaagattttaatgcagctaaagtatcacttggtgtgcttggtgttatttcacaggta |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9057869 |
aaagttgatattcttaatgaacaaaacaatgaagattttaatgcagttaaagtatcacttggtgtgcttggtgttatttcacaggta |
9057955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 79
Target Start/End: Complemental strand, 493745 - 493690
Alignment:
| Q |
24 |
actggtgctcatggaagcacattgtcggggaaaggaagtgcggttcatgactatgt |
79 |
Q |
| |
|
|||||||| |||||||| ||||||| ||| ||||||||||| |||||||| ||||| |
|
|
| T |
493745 |
actggtgcacatggaagtacattgtggggtaaaggaagtgctgttcatgagtatgt |
493690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University