View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21376_low_9 (Length: 267)

Name: NF21376_low_9
Description: NF21376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21376_low_9
NF21376_low_9
[»] chr6 (2 HSPs)
chr6 (104-255)||(7897766-7897917)
chr6 (1-109)||(7897578-7897686)
[»] chr5 (1 HSPs)
chr5 (172-235)||(27895716-27895779)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 104 - 255
Target Start/End: Original strand, 7897766 - 7897917
Alignment:
104 ttttttggtttctagtggtcaagatttgaaggtgggggaggtgtggtttaatgatgcctttgcgtagggagttgtttgcttgggaaaaagagcttttaca 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
7897766 ttttttggtttctagtggtcaagatttgaaggtgggggaggtgtggtttaatgatgcctttgcgtagggagttgtttgcttgggaaaaggagcttttaca 7897865  T
204 aagccnnnnnnnaaggttggaaggggtggagttgcgggaaggggacgattgt 255  Q
    |||||       ||||||||||||||||||||||||||||||||||||||||    
7897866 aagcctttttctaaggttggaaggggtggagttgcgggaaggggacgattgt 7897917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 7897686 - 7897578
Alignment:
1 ccggactttgaaccaaataactaggatatttattaccaagtagtgacaaagagtggattcagaaatcttaatcttttttagttttaacatcctattaaac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7897686 ccggactttgaaccaaataactaggatatttattaccaagtagtgacaaagagtggattcagaaatcttaatcttttttacttttaacatcctattaaac 7897587  T
101 ccatttttt 109  Q
    |||||||||    
7897586 ccatttttt 7897578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 27895779 - 27895716
Alignment:
172 gagttgtttgcttgggaaaaagagcttttacaaagccnnnnnnnaaggttggaaggggtggagt 235  Q
    ||||||||||||| |||||| ||||||||||||||||       ||||||||||||||||||||    
27895779 gagttgtttgctttggaaaatgagcttttacaaagcctttttttaaggttggaaggggtggagt 27895716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University