View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21376_low_9 (Length: 267)
Name: NF21376_low_9
Description: NF21376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21376_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 104 - 255
Target Start/End: Original strand, 7897766 - 7897917
Alignment:
| Q |
104 |
ttttttggtttctagtggtcaagatttgaaggtgggggaggtgtggtttaatgatgcctttgcgtagggagttgtttgcttgggaaaaagagcttttaca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7897766 |
ttttttggtttctagtggtcaagatttgaaggtgggggaggtgtggtttaatgatgcctttgcgtagggagttgtttgcttgggaaaaggagcttttaca |
7897865 |
T |
|
| Q |
204 |
aagccnnnnnnnaaggttggaaggggtggagttgcgggaaggggacgattgt |
255 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897866 |
aagcctttttctaaggttggaaggggtggagttgcgggaaggggacgattgt |
7897917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 7897686 - 7897578
Alignment:
| Q |
1 |
ccggactttgaaccaaataactaggatatttattaccaagtagtgacaaagagtggattcagaaatcttaatcttttttagttttaacatcctattaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7897686 |
ccggactttgaaccaaataactaggatatttattaccaagtagtgacaaagagtggattcagaaatcttaatcttttttacttttaacatcctattaaac |
7897587 |
T |
|
| Q |
101 |
ccatttttt |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
7897586 |
ccatttttt |
7897578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 172 - 235
Target Start/End: Complemental strand, 27895779 - 27895716
Alignment:
| Q |
172 |
gagttgtttgcttgggaaaaagagcttttacaaagccnnnnnnnaaggttggaaggggtggagt |
235 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27895779 |
gagttgtttgctttggaaaatgagcttttacaaagcctttttttaaggttggaaggggtggagt |
27895716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University