View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21378_high_3 (Length: 237)
Name: NF21378_high_3
Description: NF21378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21378_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 43933426 - 43933199
Alignment:
| Q |
1 |
agaggtatctataagaacatggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933426 |
agaggtatctataagaacatggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctg |
43933327 |
T |
|
| Q |
101 |
aggttgctttgctgtttcgtttgcgccatccaaatatcatttcagtaagttctgtttcttcaatcatttctatttatatatagtatataccaaccataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933326 |
aggttgctttgctgtttcgtttgcgccatccaaatatcatttcagtaagttctgtttcttcaatcatttctatttatatatagtatataccaaccataat |
43933227 |
T |
|
| Q |
201 |
tagaaattgcagctgtagtcatgatcgt |
228 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
43933226 |
tagaaattgcagctgtagttatgatcgt |
43933199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 35132985 - 35132893
Alignment:
| Q |
21 |
ggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctgaggttgctttgct |
113 |
Q |
| |
|
||||||||| ||||||||||| ||||| || ||||| ||||| || |||||| |||| |||||||| || ||||||||||| ||||||||||| |
|
|
| T |
35132985 |
ggatgttgcaattaagcttgtgagtcagcctgaagaagatgaagatttggcttcttttcttgagaagcaatttacttctgaagttgctttgct |
35132893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University