View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21378_low_5 (Length: 233)
Name: NF21378_low_5
Description: NF21378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21378_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 37604230 - 37604015
Alignment:
| Q |
13 |
catcagtatctaaatcatcaaaatccatacttccaccaagaaactggtcacccacttttggaccatcccctgctttcatagcctcttgaattattgtcaa |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37604230 |
catctgtatctaaatcatcaaaatccatacttccaccaagaaactggtcacccacttttggaccatcccctgctttcatagcctcttgaattattgtcaa |
37604131 |
T |
|
| Q |
113 |
tatttcttctatgttttgagatgaattactttcatcattttgtgaccaattttcaccatcctccataaattctagtggcaaattctttaagaaccaaggg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37604130 |
tatttcttctatgttttgagatgaattactttcatcattttgtgaccaattttcaccatcctccataaattctagtggcaaattctttaagaaccaaggg |
37604031 |
T |
|
| Q |
213 |
tgttttttaatctctg |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37604030 |
tgttttttaatctctg |
37604015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University