View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2137_high_15 (Length: 286)
Name: NF2137_high_15
Description: NF2137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2137_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 275
Target Start/End: Original strand, 31291849 - 31292120
Alignment:
| Q |
5 |
aaatcttgattgttcttttaccatccctttatttcaaggtaaccataaaattgacatatgcccacggacgcatggttgttccgttgaagacttacacatt |
104 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
31291849 |
aaatcttgattgttcttctatcatccctttatttcaaggtaaccataaaattgacatatccccacggacgcatgtttgttccgttgaagacttgcacatt |
31291948 |
T |
 |
| Q |
105 |
tatcccatggcaaggtaggaggcttttcttgggaagttacaaagttttgaataaattggcatacatg-catcgcatgtgatgccttgatcgatctaagct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31291949 |
tatcccatggcaaggtaggaggcttttcttgggaagttacaaagttttgaatgaattggcatacatgacatcgcatgtgatgccttgatcgatctaagct |
31292048 |
T |
 |
| Q |
204 |
ctttttactttgaatttggctacgtagatctcgataaggagggagaagatggagtttaacattcctcctagt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31292049 |
ctttttactttgaatttggctacgtagatctcgataaggagggagaagatggagtttaacattcctcctagt |
31292120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University