View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2137_high_22 (Length: 251)
Name: NF2137_high_22
Description: NF2137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2137_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 51527794 - 51527554
Alignment:
| Q |
17 |
agtttgtgaacacactcaccatattaatcaaggaataagatcatcgtttctgtgctaatgtcagggttcagaaaatgttggagggaaattgaattgatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527794 |
agtttgtgaacacactcaccatattaatcaaggaataagatcatcgttgctgtggtaatgttagggttcagaaaatgttggagggaaattgaattgatgt |
51527695 |
T |
 |
| Q |
117 |
gattgatctaataagaagaaaacgggtcggagtagattgtgatcagaatattatgggctttttaaatcactacaccgtcttttccttattgctgc----- |
211 |
Q |
| |
|
|| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527694 |
gagtgatataataagaagaaaacggatcggagtagattgtgatcagaatattatgggctttttaaatcactacaccgtcttttccttattgctgctgctg |
51527595 |
T |
 |
| Q |
212 |
----tgctaaatgcacatccctactcccaagtccgcgccca |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527594 |
ctgctgctaaatgcacatccctactcccaagtccgcgccca |
51527554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University