View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2137_high_23 (Length: 249)
Name: NF2137_high_23
Description: NF2137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2137_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 38483268 - 38483054
Alignment:
| Q |
15 |
acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggaggaggacatgttcccgttggttgcggacat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38483268 |
acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggaggaggacatgttctcgttggttgcggacat |
38483169 |
T |
|
| Q |
115 |
tgtctgtctggaagccgaaaaagagggctagccaatttaggaggtcgtagtgtggttgccatttgggaggaaggtggaggtcaccgacggtgttgagggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483168 |
tgtctgtctggaagccgaaaaagagggctagccaatctaggaggtcgtagtgtggttgccatttgggaggaaggtggaggtcaccgacggtgttgagggc |
38483069 |
T |
|
| Q |
215 |
ggagaaggcagcgcg |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38483068 |
ggagaaggcagcgcg |
38483054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 148
Target Start/End: Complemental strand, 30117655 - 30117522
Alignment:
| Q |
15 |
acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggaggaggacatgttcccgttggttgcggacat |
114 |
Q |
| |
|
|||| ||| ||||| | ||||||||| || || || ||| ||||||||||||||||||||||||| || || | | ||| |||||||| || ||||| | |
|
|
| T |
30117655 |
acagcggcgtcgagagtatcgatgttatccggcggcggagtgagacgcatctgagcattggcgaggtgaagaacaagatgctcccgttgattacggacgt |
30117556 |
T |
|
| Q |
115 |
tgtctgtctggaagccgaaaaagagggctagcca |
148 |
Q |
| |
|
||||| |||| |||||||| ||||| || ||||| |
|
|
| T |
30117555 |
tgtctttctgaaagccgaagaagagagcgagcca |
30117522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University