View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2137_low_29 (Length: 249)

Name: NF2137_low_29
Description: NF2137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2137_low_29
NF2137_low_29
[»] chr2 (1 HSPs)
chr2 (15-229)||(38483054-38483268)
[»] chr4 (1 HSPs)
chr4 (15-148)||(30117522-30117655)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 38483268 - 38483054
Alignment:
15 acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggaggaggacatgttcccgttggttgcggacat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
38483268 acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggaggaggacatgttctcgttggttgcggacat 38483169  T
115 tgtctgtctggaagccgaaaaagagggctagccaatttaggaggtcgtagtgtggttgccatttgggaggaaggtggaggtcaccgacggtgttgagggt 214  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
38483168 tgtctgtctggaagccgaaaaagagggctagccaatctaggaggtcgtagtgtggttgccatttgggaggaaggtggaggtcaccgacggtgttgagggc 38483069  T
215 ggagaaggcagcgcg 229  Q
    |||||||||||||||    
38483068 ggagaaggcagcgcg 38483054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 148
Target Start/End: Complemental strand, 30117655 - 30117522
Alignment:
15 acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggaggaggacatgttcccgttggttgcggacat 114  Q
    |||| ||| ||||| | ||||||||| || || || ||| ||||||||||||||||||||||||| || || |  | ||| |||||||| || ||||| |    
30117655 acagcggcgtcgagagtatcgatgttatccggcggcggagtgagacgcatctgagcattggcgaggtgaagaacaagatgctcccgttgattacggacgt 30117556  T
115 tgtctgtctggaagccgaaaaagagggctagcca 148  Q
    ||||| |||| |||||||| ||||| || |||||    
30117555 tgtctttctgaaagccgaagaagagagcgagcca 30117522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University